Quick Order

Human CD50 / ICAM3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICAM3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002162.3
RefSeq ORF Size:1644bp
cDNA Description:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 3 with C terminal His tag.
Gene Synonym:CD50, CDW50, ICAM-R
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

References
  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.
  • Size / Price
    Catalog: HG10333-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"