After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CST9L Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST9LcDNA Clone Product Information
cDNA Size:444
cDNA Description:ORF Clone of Homo sapiens cystatin 9-like DNA.
Gene Synonym:bA218C14.1, CST9L
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are strikingly restricted to reproductive tissue. Cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. There are typically about 115 amino acids in this family. They are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds, may be glycosylated and/or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Testatin shows homology to family 2 cystatins, a group of broadly expressed small secretory proteins that are inhibitors of cysteine proteases in vitro but whose in vivo functions are unclear. It is expressed in germ cells and somatic cells in reproductive tissues. Testatin is considered a strong candidate for involvement in early testis development. Testatin expression is maintained in the adult Sertoli cell, and it can also be found in a small population of germ cells.

  • Dickinson DP, et al. (1993) Genomic cloning, physical mapping, and expression of human type 2 cystatin genes. Crit Rev Oral Biol. 4(3-4):573-80.
  • Dickinson DP, et al. (1995) Direct mapping of seven genes encoding human type 2 cystatins to a single site located at 20p11.2. Genomics. 24(1):172-5.
  • Thiesse M, et al. (1994) The human type 2 cystatin gene family consists of eight to nine members, with at least seven genes clustered at a single locus on human chromosome 20. DNA Cell Biol. 13(2): 97-116.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items