Quick Order

Human AZGP1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AZGP1 cDNA Clone Product Information
Gene_bank_ref_id:BC033830
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Homo sapiens alpha-2-glycoprotein 1, zinc-binding with N terminal Flag tag.
Gene Synonym:ZAG, ZA2G, AZGP1
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be detected in body fluids such as serum, sweat, and seminal and breast cyst fluids. It has been shown that alpha-2-glycoprotein can stimulate lipolysis by adipocytes in vivo and in vitro. Thus it is believed that alpha-2-glycoprotein plays an important role in the regulation of body weight, and age-dependent changes in genetically influenced obesity, and it also regulates melanin production by normal and malignant melanocytes. Alpha-2-glycoprotein is produced by both white and brown fat adipocytes and may act in a local autocrine fashion in the reduction of adiposity in cachexia.

References
  • Tada T, et al. (1991) Immunohistochemical localization of Zn-alpha 2-glycoprotein in normal human tissues. J Histochem Cytochem. 39(9):1221-6.
  • Vanni H, et al. (2009) Cigarette Smoking Induces Overexpression of a Fat-Depleting Gene AZGP1 in the Human. Chest. 135(5):1197-208.
  • Ueyama H, et al. (1991) Cloning and nucleotide sequence of a human Zn-alpha 2-glycoprotein cDNA and chromosomal assignment of its gene. Biochem Biophys Res Commun. 177(2):696-703.
  • Size / Price
    Catalog: HG13242-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"