After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SOCS3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SOCS3cDNA Clone Product Information
cDNA Size:677
cDNA Description:ORF Clone of Homo sapiens suppressor of cytokine signaling 3 DNA.
Gene Synonym:CIS3, SSI3, ATOD4, Cish3, SSI-3, SOCS-3, MGC71791, SOCS3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Suppressor of cytokine signaling 3, also known as SOCS-3, Cytokine-inducible SH2 protein 3, CIS-3, STAT-induced STAT inhibitor 3, SOCS3 and CIS3, is a protein which is widely expressed with high expression in heart, placenta, skeletal muscle, peripheral blood leukocytes, fetal and adult lung, and fetal liver and kidney. SOCS3 / CIS3 contains one SH2 domain and one SOCS box domain. SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 / CIS3 is involved in negative regulation of cytokines that signal through the JAK / STAT pathway. SOCS3 / CIS3 inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. SOCS3 / CIS3 suppresses fetal liver erythropoiesis. It regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. SOCS3 / CIS3 regulates IL-6 signaling. SOCS3 / CIS3 interacts with multiple activated proteins of the tyrosine kinase signaling pathway including IGF1 receptor, insulin receptor and JAK2. SOCS3 / CIS3 could be used as a possible therapeutic agent for treating rheumatoid arthritis.

  • Hoertner M., et al., 2002, Eur. J. Biochem. 269:2516-26.
  • Yamamoto K., et al., 2003, Biochem. Biophys. Res. Commun. 310 : 1188-93.
  • Kamura T., et al., 2004, Genes Dev. 18:3055-65.
  • Okamura A., et al., 2004, Blood 103:2997-3004.
  • Ekelund E., et al., 2006, Am. J. Hum. Genet. 78:1060-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items