After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HGFA ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HGFA cDNA Clone Product Information
Gene_bank_ref_id:NM_001528.2
RefSeq ORF Size:1968bp
cDNA Description:Full length Clone DNA of Homo sapiens HGF activator with C terminal His tag.
Gene Synonym:HGFA, MGC138395, MGC138397
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-HGFAC-His
Restriction Site:HindIII + XbaI (6kb + 2.02kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HGFA Gene Plasmid Map
Human HGFA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

HGF activator (HGFA) is a serum-derived serine protease and belongs to the peptidase family S1.HGFA is responsible for the conversion of hepatocyte growth factor (HGF), from the inactive single-chain precursor to the active heterodimeric form, which is a potent mitogen, motogen, and morphogen for liver cells, epithelial cells, and endothelial cells. HGFA is synthesized and secreted by the liver and circulates in the plasma as an inactive single-chain zymogen in normal states. The zymogen is cleaved by thrombin or thermolysin through the endoproteolytic process and forms an active heterodimer linked by a disulfide bond. In turn, the active protease can be inhibited by HGFA inhibitors (HAIs) including HAI-1 and HAI-2. In addition, the HGFA zymogen acquires a strong affinity upon activation and thus may ensure the local action in tissue regeneration in liver, kidney and skin. It has been reported that activation of HGF is a critical limiting step in the HGF/SF-induced signaling pathway mediated by Met, and accordingly, aberrant expression of HGFA is implicated in tumorigenesis and progression.

References

1.  Shimomura, T. et al., 1993, J. Biol. Chem. 268: 22927-22932.

2.  Miyazawa, K. et al., 1996, J. Biol. Chem. 271 : 3615-3618.

3.  Shia, S. et al., 2005, J. Mol. Biol. 346: 1335-1349.

4.  Kataoka, H. et al., 2000, J. Biol. Chem. 275: 40453-40462.

5.  Tjin, E.P. et al., 2006, Blood. 107: 760-768.

6.  Kitajima, Y. et al., 2000, Cancer. Res. 60: 6148-6159.

Size / Price
Catalog: HG10329-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"