Quick Order

Text Size:AAA

Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HMGB1cDNA Clone Product Information
Gene_bank_ref_id:NM_002128.4
cDNA Size:693
cDNA Description:ORF Clone of Homo sapiens high-mobility group box 1 DNA.
Gene Synonym:HMG1, HMG3, SBP-1, DKFZp686A04236
Species:Human
Vector:pCMV3-C-His
Restriction Site:KpnI + XbaI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10326-ACG$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10326-ACR$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10326-ANG$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10326-ANR$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10326-CF$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10326-CH$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10326-CM$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10326-CY$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone)HG10326-M$95
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10326-M-F$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10326-M-H$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10326-NF$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10326-NH$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10326-NM$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10326-NY$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10326-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2 and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis is present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal "necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. In addition, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.

References
  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
  • Size / Price
    Catalog:HG10326-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    Images
    • Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"