After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TYRP1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TYRP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000550.2
RefSeq ORF Size:1614bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosinase-related protein 1 with N terminal Flag tag.
Gene Synonym:TRP, CAS2, CATB, GP75, TYRP, b-PROTEIN, TYRP1
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Tyrosinase-related protein 1, also known as TYRP1 or TRP1, is a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Mutations in this enzyme are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. TYRP1 / TRP1 is involved in the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid. This enzyme may regulate or influence the type of melanin synthesized. The expression of Tyrosinase-related protein 1 (TYRP1) is regulated by the microphthalmia-associated transcription factor (MITF). There is mounting evidence demonstrating that in addition to its role in eumelanin synthesis, TYRP1 is involved in maintaining stability of tyrosinase proliferation and melanocyte cell death.

References
  • Sarangarajan R, et al. (2001) Tyrp1 and oculocutaneous albinism type 3. Pigment Cell Res. 14(6): 437-44.
  • Box NF, et al. (1998) Complete sequence and polymorphism study of the human TYRP1 gene encoding tyrosinase-related protein 1. Genome. 9 (1): 50-3.
  • Size / Price
    Catalog: HG13224-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"