Quick Order

Text Size:AAA

Human AKR1B1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKR1B1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001628.2
RefSeq ORF Size:951bp
cDNA Description:Full length Clone DNA of Homo sapiens aldo-keto reductase family 1, member B1 (aldose reductase) with N terminal Myc tag.
Gene Synonym:AR, ADR, ALR2, ALDR1, MGC1804, AKR1B1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as the rate-limiting enzyme of the polyol pathway. Expression of AKR1B1 was the highest in lens and retina. It is the first enzyme in the polyol pathway through which glucose is converted to sorbitol which is important for the function of various organs in the body, and has been implicated in the etiology of diabetic complications. AKR1B1 is quite abundant in the collecting tubule cells and thought to provide protection against hypertonic environment. Some human tissues contain AKR1B1 as well as AKR1B10, a closely related member of the aldo-keto reductase superfamily. 

References
  • Huang SP, et al. (2010) Aldo-Keto Reductases in the Eye. Journal of Ophthalmology. 326 (3): 625-36.
  • Aida K, et al. (2000) Disruption of Aldose Reductase Gene (Akr1b1) Causes Defect in Urinary Concentrating Ability and Divalent Cation Homeostasis. Biochemical and Biophysical Research Communications.277 (2): 281-6.
  • Liao CS, et al. (2009) Regulation of AKR1B1 by thyroid hormone and its receptors. Molecular and Cellular Endocrinology. 307 (1-2): 109-17.
  • Baba SP, et al. (2009) Posttranslational glutathiolation of aldose reductase (AKR1B1): A possible mechanism of protein recovery from S-nitrosylation. Chemico-Biological Interactions. 178 (1-3): 250-8.
  • Size / Price
    Catalog: HG11294-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"