After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CCL3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002983.2
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 3 with N terminal Myc tag.
Gene Synonym:MIP1A, SCYA3, G0S19-1, LD78ALPHA, MIP-1-alpha, CCL3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.

References
  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
  • Size / Price
    Catalog: HG11292-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"