Quick Order

Text Size:AAA

Human SERPINB3 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_006919.2
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3 with N terminal Flag tag.
Gene Synonym:SCC, T4-A, SCCA1, SCCA-1, HsT1196, SCCA-PD, SERPINB3
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SERPINB3, also known as SCCA-1, belongs to the serpin family. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases. SERPINB3 is expressed in some hepatocellular carcinoma (at protein level). Its expression is closely related to cellular differentiation in both normal and malignant squamous cells. It seems to also be secreted in plasma by cancerous cells but at a low level. SERPINB3 significantly attenuates apoptosis by contrasting cytochrome c release from the mitochondria and by antichemotactic effect for NK cells. It may act as a protease inhibitor to modulate the host immune response against tumor cells and may be involved in the malignant behavior of squamous cell carcinoma cells.

References
  • Schneider SS, et al. (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci. 92(8):3147-51.
  • Suminami Y, et al.. (1992) Squamous cell carcinoma antigen is a new member of the serine protease inhibitors. Biochem Biophys Res Commun. 181(1):51-8.
  • Mino-Miyagawa N, et al. (1990) Tumor-antigen 4. Its immunohistochemical distribution and tissue and serum concentrations in squamous cell carcinoma of the lung and esophagus. Cancer. 66(7):1505-12.
  • Size / Price
    Catalog: HG13218-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"