Quick Order

Text Size:AAA

Human SerpinA5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA5cDNA Clone Product Information
Gene_bank_ref_id:NM_000624.4
cDNA Size:1221
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 DNA.
Gene Synonym:PCI, PAI3, PROCI, PLANH3
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Serpin A5, also well known as protein C inhibitor (PCI), is a member of the human serpin superfamily consists of at least 35 members. It is synthesized in the liver and has been detected in saliva, cerebral spinal fluid, amniotic fluid, tears and semen. As a potent inhibitor of the protein C anticoagulant pathway at the levels of both zymogen activation and enzyme inhibition, serpinA5 additionally inhibits a variety of serine protease including thrombin, factor Xa, several kallekreins and acrosin, and plays a role in the processes of blood coagulation and fertilization. Serpin A5 also inhibits urinary plasminogen activator (uPA), a mediator of tumor cell invasion, and regulates tumor growth and metastasis by inhibiting angiogenesis. Furthermore, recent studies have identified PCI as a potent and direct inhibitor of activated HGFA (hepatocyte growth factor activator), suggesting a novel function in the regulation of tissue repair and regeneration. Similar to serpins C1 and D1, the thrombin inhibitory activity of serpinA5 is enhanced by heparin.

References
  • Alireza, R. et al., 1995, J. Biol. Chem. 270: 25336-25339.
  • Silverman, G.A. et al., 2001, J. Biol. Chem. 276: 33293-33296.
  • Malleier, J.M. et al., 2007, Blood. 109: 4769-4776.
  • Asanuma, K. et al., 2007, Int. J. Cancer. 121: 955-965.
  • Hayashi, T. et al., 2007, J. Thromb. Haemost. 5: 1477-1485.
  • Size / Price
    Catalog:HG10309-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"