Quick Order

Human CD97 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD97 cDNA Clone Product Information
Gene_bank_ref_id:NM_078481.2
RefSeq ORF Size:2229bp
cDNA Description:Full length Clone DNA of Homo sapiens CD97 molecule with N terminal Myc tag.
Gene Synonym:TM7LN1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD97 is a receptor predominantly expressed in leukocytes and belongs to a new group of seven-span transmembrane molecules, which is also designed EGF-TM7 family. The family members are characterized by an extended extracellular region with several N-terminal epidermal growth factor-like domains two of which contain a calcium binding site. Muture CD 97 has two noncovalently associated subunits and is composed of a large extracellular protein (CD97 alpha) and a seven-membrane spanning protein (CD97 beta). CD97 is considered as a defining feature of G protein-coupled receptors. The effects that lymphocytes and erythrocytes adere to CD97-transfected COS cells suggest that CD97 has the ability to bind cellular ligands. CD97 alpha has three alternatively spliced isforms that are related to the calium binding EGF-like repeats in the microfibril protein fibrillin. Leukocytes strongly positive for CD97 are concentrated at sites of inflammation relative to CD97 expression in normal lymphoid tissues.

References
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Gray JX, et al. (1996) CD97 is a processed, seven-transmembrane, heterodimeric receptor associated with inflammation. The journal of Immunology. 157 (12): 5438-47.
  • Hamann J,et al. (1998) Characterization of the CD55 (DAF)-binding site on the seven-span transmembrane receptor CD97.European Journal of Immunology. 28 (5): 1701-7.
  • Size / Price
    Catalog: HG11280-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"