Quick Order

Human STAT6 ORF mammalian expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human STAT6 cDNA Clone Product Information
NCBI RefSeq:BC075852
RefSeq ORF Size:2544bp
cDNA Description:Full length Clone DNA of Homo sapiens signal transducer and activator of transcription 6 with N terminal Flag tag.
Gene Synonym:D12S1644, IL-4-STAT, STAT6B, STAT6C, STAT6
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p300 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B. 

References
  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.
  • Size / Price
    Catalog: HG13190-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"