Quick Order

Text Size:AAA

Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACOX1cDNA Clone Product Information
cDNA Size:1983
cDNA Description:ORF Clone of Homo sapiens acyl-Coenzyme A oxidase 1, palmitoyl DNA.
Gene Synonym:ACOX, SCOX, MGC1198, PALMCOX, ACOX1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11266-ACG$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11266-ACR$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11266-ANG$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11266-ANR$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11266-CF$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11266-CH$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11266-CM$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11266-CY$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone)HG11266-M$115
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11266-M-F$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11266-M-N$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11266-NF$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11266-NH$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11266-NM$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11266-NY$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11266-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and belongs to the Acyl-CoA oxidase family. Human liver peroxisomes contain two acyl-CoA oxidases, namely, palmitoyl-CoA oxidase (ACOX1/AOX) and a branched chain acyl-CoA oxidase. The palmitoyl-CoA oxidase (ACOX1/AOX) oxidizes the CoA esters of straight chain fatty acids and prostaglandins and donates electrons directly to molecular oxygen, thereby producing H2O2. Human ACOX1/AOX is a protein of 661-amino acids, including the carboxyl-terminal sequence(Ser-Lys-Leu) known as a minimal peroxisome-targeting signal. Human ACOX1/AOX, the first and rate-limiting enzyme of the peroxisomal β-oxidation pathway, has two isoforms including ACOX1a and ACOX1b, transcribed from a single gene. The human ACOX1b isoform is more effective than the ACOX1a isoform in reversing the Acox1 null phenotype in the mouse partly because of the Substrate utilization differences.

  • Vluggens A, et al. (2010) Functional significance of the two ACOX1 isoforms and their crosstalks with PPAR alpha and RXR alpha. Laboratory Investigation. 90: 696-708.
  • Chu R, et al. (1995) Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells. J Biol Chem. 270 (9): 4908-15.
  • Aoyama T, et al. (1994) Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase. Biochem Biophys Res Commun. 198 (3): 1113-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items