After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PRDX2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDX2cDNA Clone Product Information
cDNA Size:597
cDNA Description:ORF Clone of Homo sapiens peroxiredoxin 2 DNA.
Gene Synonym:PRP, TSA, PRX2, NKEFB, PRXII, TDPX1, MGC4104, PRDX2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PRDX2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items