Quick Order

Text Size:AAA

Human PTPRJ ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPRJ cDNA Clone Product Information
Gene_bank_ref_id:NM_002843.3
RefSeq ORF Size:4014bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type, J with N terminal Flag tag.
Gene Synonym:DEP1, SCC1, CD148, HPTPeta, R-PTP-ETA, PTPRJ
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. DEP1 / PTPRJ possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. DEP1 / PTPRJ is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. In stable MCF-7 cell lines lines, induction of DEP-1 expression inhibited breast cancer cell growth by 5-10-fold. These data describe PTPs expressed and regulated in breast cancer cell lines during differentiation and identify one PTP, DEP-1, that inhibits the growth of breast cancer cells in vitro.

References
  • Holsinger LJ, et al. (2002) The transmembrane receptor protein tyrosine phosphatase DEP1 interacts with p120. Oncogene. 21(46): 7067-76.
  • Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet. 41(4): 494-7.
  • Kuramochi S, et al. (1996) Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1. FEBS Lett. 378(1): 7-14.
  • Size / Price
    Catalog: HG13165-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"