Quick Order

Text Size:AAA

Human ACPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACPL2cDNA Clone Product Information
Gene_bank_ref_id:NM_152282.3
cDNA Size:1443
cDNA Description:ORF Clone of Homo sapiens acid phosphatase-like 2 DNA.
Gene Synonym:FLJ23751, ACPL2
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

References
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • Size / Price
    Catalog:HG11243-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"