Quick Order

Text Size:AAA

Cynomolgus monkey PNP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PNP cDNA Clone Product Information
Gene_bank_ref_id:XM_005560695.1
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) purine nucleoside phosphorylase with N terminal His tag.
Gene Synonym:PNP
Species:Cynomolgus
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • de Azevedo,W.F. et al., 2003, Biochem Biophys Res Commun. 312 (3): 767-72.
  • Canduri,F. et al., 2005, Acta Crystallogr D Biol Crystallogr. 61 (Pt 7): 856-62.
  • Perera,G.K. et al., 2005,Clin Exp Dermatol. 30 (1):27-9.
  • Size / Price
    Catalog: CG90410-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"