Quick Order

Text Size:AAA

Human OSMR / IL-31RB Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OSMRcDNA Clone Product Information
cDNA Size:2940
cDNA Description:ORF Clone of Homo sapiens oncostatin M receptor1 DNA.
Gene Synonym:OSMRB, MGC75127, MGC150626, MGC150627,
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

  • Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.
  • Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.
  • Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks