Quick Order

Human LY96 / MD-2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LY96 cDNA Clone Product Information
Gene_bank_ref_id:NM_015364.2
RefSeq ORF Size:483bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 96 with C terminal His tag.
Gene Synonym:LY96, MD2, MD-2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

LY-96, also known as ESOP-1, is a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS). LY-96 also cooperates with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. It enhances TLR4-dependent activation of NF-kappa-B. ESOP-1 has 160 amino acids, the sequence of which shows 64% identity with human ESOP-1/MD-2. ESOP-1 mRNA is highly expressed in the mouse embryos at 7.5 days after coitus.

Size / Price
Catalog: HG10243-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"