After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AGO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AGO1cDNA Clone Product Information
cDNA Size:2574
cDNA Description:ORF Clone of Homo sapiens eukaryotic translation initiation factor 2C, 1 DNA.
Gene Synonym:Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human AGO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Size / Price
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items