Quick Order

Text Size:AAA

Human DNMT2 / TRDMT1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TRDMT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004412.4
RefSeq ORF Size:1176bp
cDNA Description:Full length Clone DNA of Homo sapiens tRNA aspartic acid methyltransferase 1 with N terminal Myc tag.
Gene Synonym:DMNT2, DNMT2, PuMet, RNMT1, M.HsaIIP, TRDMT1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA methyltransferase family of enzymes. DNMT2 enzymes have been widely conserved during evolution and contain all of the signature motifs of DNA (cytosine-5)-methyltransferases. It contains all 10 sequence motifs that are conserved among m(5)C MTases, including the consensus S:-adenosyl-L-methionine-binding motifs and the active site ProCys dipeptide, and its structure is very similar to prokaryotic DNA methyltransferases. DNMT2 has close homologs in plants, insects and Schizosaccharomyces pombe, but no related sequence can be found in the genomes of Saccharomyces cerevisiae or Caenorhabditis elegans. While the biological function of DNMT2 is not yet known, the strong binding to DNA suggests that DNMT2 may mark specific sequences in the genome by binding to DNA through the specific target-recognizing motif. However, the DNA methyltransferase activity of these proteins is comparatively weak and their biochemical and functional properties remain enigmatic. Recent evidence now shows that Dnmt2 has a novel tRNA methyltransferase activity, raising the possibility that the biological roles of these proteins might be broader than previously thought.

References
  • Dong A, et al. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA. Nucleic Acids Res. 29(2): 439-48.
  • Hermann A, et al. (2003) The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 278(34): 31717-21.
  • Jeltsch A, et al. (2006) Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 31(6): 306-8.
  • Schaefer M, et al. (2010) Solving the Dnmt2 enigma. Chromosoma. 119(1): 35-40.
  • Size / Price
    Catalog: HG11224-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"