Quick Order

Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHIT1cDNA Clone Product Information
cDNA Size:1401
cDNA Description:ORF Clone of Homo sapiens chitinase 1 (chitotriosidase) DNA.
Gene Synonym:CHI3, CHIT, FLJ00314, MGC125322
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11223-ACG$325
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11223-ACR$325
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11223-CF$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11223-CH$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11223-CM$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11223-CY$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone)HG11223-M$195
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11223-M-N$395
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11223-NF$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11223-NH$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11223-NM$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11223-NY$295
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11223-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items