Quick Order

Text Size:AAA

Human PRDM2 / RIZ1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDM2cDNA Clone Product Information
cDNA Size:1514
cDNA Description:ORF Clone of Homo sapiens PR domain containing 2, with ZNF domain DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PRDM2 / RIZ1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

PR domain containing 2, with ZNF domain (PRDM2), also known as zinc finger protein RIZ, is a member of histone methyltransferase (HMT) class enzymes that methylate lysine residues of histones or proteins. HMTs contain a conserved catalytic core termed the SET domain, which shares sequence homology with an independently described sequence motif, the PR domain. PRDM2 contains 8 C2H2-type zinc fingers and a distinct SET domain, and is highly expressed in retinoblastoma cell lines and in brain tumors, as well as in a number of other cell lines and in brain, heart, skeletal muscle, liver and spleen. PRDM2 is a S-adenosyl-L-methionine-dependent histone methyltransferase that specifically methylates 'Lys-9' of histone H3, and is identified as a tumor suppressor. It is reported that intact PR( SET) sequence is required for tumor suppression functions, mutations in the PR domain caused activity reduction in human cancers. Also, S-adenosylhomocysteine or methyl donor deficiency inhibits RIZ1 and other H3 lysine 9 methylation activities. PRDM2 may also function as a DNA-binding transcription factor. It Binds to the macrophage-specific TPA-responsive element (MTE) of the HMOX1 (heme oxygenase 1) gene and act as a transcriptional activator. In addition, PRDM2 (RIZ) is able to binds to the retinoblastoma protein (RB) and also Interacts with GATA3.

  • Buyes, I.M. et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92: 4467-4471.
  • Muraosa, Y. et al., 1996, Eur. J. Biochem. 235: 471-479.
  • Kim, K. et al., 2003, Cancer. Res. 63: 7619-7623.
  • Shapiro, V.S. et al., 1995, Gene. 163: 329-330.
  • Briknarova, K.et al.,2008,Biochem.Biophys.Res.Commun.366:807-813.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items