After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROCRcDNA Clone Product Information
cDNA Size:717
cDNA Description:ORF Clone of Homo sapiens protein C receptor, endothelial (EPCR) DNA.
Gene Synonym:CCCA, EPCR, CCD41, CD201, bA42O4.2, PROCR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.