Quick Order

Text Size:AAA

Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HPGDcDNA Clone Product Information
cDNA Size:801
cDNA Description:ORF Clone of Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD), transcript variant 1 DNA.
Gene Synonym:PGDH, PGDH1, 15-PGDH, SDR36C1, HPGD
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11205-ACG$325
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11205-ACR$325
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11205-ANG$325
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11205-ANR$325
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11205-CF$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11205-CH$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11205-CM$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11205-CY$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11205-M$95
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11205-M-F$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11205-M-N$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11205-NF$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11205-NH$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11205-NM$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11205-NY$295
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11205-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse 15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.

  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items