Quick Order

Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSRP1cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Homo sapiens cysteine and glycine-rich protein 1 DNA.
Gene Synonym:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11201-ACG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11201-ACR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11201-ANG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11201-ANR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11201-CF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11201-CH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11201-CM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11201-CY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone)HG11201-M$95
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11201-M-F$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-M-N$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11201-NF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11201-NH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11201-NM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11201-NY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items