Quick Order

Human KRT14 ORF mammalian expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human KRT14 cDNA Clone Product Information
NCBI RefSeq:NM_000526.4
RefSeq ORF Size:1419bp
cDNA Description:Full length Clone DNA of Homo sapiens keratin 14 with N terminal Flag tag.
Gene Synonym:K14, NFJ, CK14, EBS3, EBS4, KRT14
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cytokeratin 14, also known as Keratin 14 and K14, is a member of the keratin family. Cytokeratin 14 is a type I keratin. It is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Cytokeratin 14 is mainly expressed in the basal layer. It is also strongly expressed in the outer root sheath of anagen follicles. Cytokeratin 14 and keratin 5 may have a role in maintenance of cell proliferation potential in the basal layer of stratified epithelia, modulating phosphatidylinositol 3-kinase/Akt–mediated cell proliferation and/or Notch1-dependent cell differentiation. Cytokeratin 14 defect prevents it from working effectively with keratin 5 and interfering with the assembly of the keratin intermediate filament network. A disruption in this network makes keratinocytes fragile and prone to rupture. Minor trauma to the skin, such as rubbing or scratching, can cause these cells to break down, resulting in the formation of painful, fluid-filled blisters. Mutations in the K14 gene are also responsible for Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis.

References
  • Coulombe PA, et al., 1991, Cell. 66(6): 1301-11.
  • Schweizer J, et al., 2006, 174(2): 169-74.
  • Lugassy J, et al., 2006, Am J Hum Genet. 79(4): 724-30.
  • Size / Price
    Catalog: HG13109-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeks
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"