Quick Order

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDX1cDNA Clone Product Information
cDNA Size:600
cDNA Description:ORF Clone of Homo sapiens peroxiredoxin 1 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11194-ACG$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11194-ACR$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11194-ANG$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11194-ANR$325
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11194-CF$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11194-CH$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11194-CM$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11194-CY$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone)HG11194-M$195
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11194-M-F$395
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11194-M-N$395
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11194-NF$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11194-NH$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11194-NM$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11194-NY$295
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11194-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.