Quick Order

Text Size:AAA

Human KLK-13 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK13cDNA Clone Product Information
Gene_bank_ref_id:NM_015596.1
cDNA Size:834
cDNA Description:ORF Clone of Homo sapiens kallikrein-related peptidase 13 DNA.
Gene Synonym:KLK13, KLKL4, KLK-L4, DKFZP586J1923
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Human tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.

Size / Price
Catalog:HG10199-CH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"