After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100BcDNA Clone Product Information
Gene_bank_ref_id:NM_006272.2
cDNA Size:279
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein B DNA.
Gene Synonym:S100B, NEF, S100, S100beta
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10181-ACG$325
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10181-ACR$325
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10181-ANG$325
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10181-ANR$325
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10181-CF$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10181-CH$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10181-CM$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10181-CY$295
Human S100B Gene cDNA Clone (full-length ORF Clone)HG10181-M$95
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10181-M-F$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10181-M-N$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10181-NF$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10181-NH$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10181-NM$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10181-NY$295
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10181-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

References
  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.
  • Size / Price
    Catalog:HG10181-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"