After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BPIFB1 / C20ORF114 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BPIFB1cDNA Clone Product Information
Gene_bank_ref_id:BC008429
cDNA Size:1455
cDNA Description:ORF Clone of Homo sapiens chromosome 20 open reading frame 114 DNA.
Gene Synonym:LPLUNC1, C20orf114, BPIFB1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. BPIFB1 is expressed in the upper respiratory tract and oral cavity, which may function in host defence. The expression of BPIF proteins is associated with CF lung disease in humans and mice. It is unclear if this elevation of protein production, which results from phenotypic alteration of the cells within the diseased epithelium, plays a role in the pathogenesis of the disease. BPIFB1 is an abundant, secreted product of goblet cells and minor mucosal glands of the respiratory tract and oral cavity and suggest that the protein functions in the complex milieu that protects the mucosal surfaces in these locations.

Size / Price
Catalog:HG13275-CM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"