Quick Order

Human PDE2A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDE2A cDNA Clone Product Information
Gene_bank_ref_id:NM_002599.3
RefSeq ORF Size:2826bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphodiesterase 2A, cGMP-stimulated with N terminal Flag tag.
Gene Synonym:PDE2A1, PED2A4, PDE2A
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

cGMP-dependent 3',5'-cyclic phosphodiesterase, also known as cyclic GMP-stimulated phosphodiesterase and PDE2A, is a peripheral membrane protein which belongs to the cyclic nucleotide phosphodiesterase family and PDE2 subfamily. Phosphodiesterases (PDEs) comprise a family of enzymes that regulate the levels of cyclic nucleotides, key second messengers that mediate a diverse array of functions. Phosphodiesterases (PDEs) modulate signaling by cyclic nucleotides in diverse processes such as cardiac contractility, platelet aggregation, lipolysis, glycogenolysis, and smooth muscle contraction. PDE2A is an evolutionarily conserved cGMP-stimulated cAMP and cGMP PDE. PDE2A contains two GAF domains. PDE2A is expressed in brain and to a lesser extent in heart, placenta, lung, skeletal muscle, kidney and pancreas. PDE2A is a cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. PDE2A is involved in the regulation of blood pressure and fluid homeostasis by the atrial natriuretic peptide (ANP), making PDE2-type enzymes important targets for drug discovery.

References
  • Iffland,A. et al., 2005, Biochemistry. 44 (23):8312-25
  • de Oliveira,S.K. et al., 2007,J Biol Chem. 282 (18):13656-63.
  • Stephenson,D.T. et al., 2009, J Histochem Cytochem. 57 (10):933-49.
  • Russwurm,C. et al., 2009, J Biol Chem. 284 (38):25782-90.
  • Size / Price
    Catalog: HG13031-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"