Quick Order

Text Size:AAA

Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GADD45AcDNA Clone Product Information
cDNA Size:498
cDNA Description:ORF Clone of Homo sapiens growth arrest and DNA.-damage-inducible, alpha DNA.
Gene Synonym:DDIT1, GADD45, GADD45A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11156-ACG$325
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11156-ACR$325
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11156-ANG$325
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11156-ANR$325
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11156-CF$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11156-CH$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11156-CM$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11156-CY$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone)HG11156-M$95
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11156-M-F$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11156-M-N$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11156-NF$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11156-NH$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11156-NM$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11156-NY$295
Human GADD45A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11156-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

GADD45A is a member of the GADD45 Family, and has been found to associate with several cytoplasmic and nuclear factors and has been implicated in several cellular functions, including MAPK signaling, cell cycle regulation, DNA repair and genomic stability, apoptosis, and immune responses. The GADD45 Family of genes is rapidly induced by different stressors, including differentiation-inducing cytokines, and there is a large body of evidence that their cognate proteins are key players in cellular stress responses. GADD45A protein has been reported to interact with multiple important cellular proteins, including Cdc2 protein kinase, proliferating cell nuclear antigen (PCNA), p21Waf1/Cip1 protein, core histone protein and MTK/MEKK4, an up-stream activator of the JNK/SAPK pathway, indicating that GADD45A may play important roles in the control of cell cycle checkpoint, DNA repair process, and signaling transduction. GADD45A expression in response to genotoxic stress illustrates a more complex scenario, wherein transcriptional changes operate in concert with mRNA turnover and translational regulation. GADD45A was the first stress-inducible gene determined to be up-regulated by p53 and is also a target for the p53 homologues, p63 and p73. The decreased GADD45A expression is also considered a survival mechanism, as cancer cells without this control can evade the apoptotic pathway leading to increased tumourigenesis. As GADD45A is an essential component of many metabolic pathways that control proliferating cancer cells, it presents itself as an emerging drug target worthy of further investigation.

  • Zhan Q. (2005) Gadd45a, a p53- and BRCA1-regulated stress protein, in cellular response to DNA damage. Mutat Res. 569(1-2): 133-43.
  • Lal A, et al. (2006) Egad, more forms of gene regulation: the gadd45a story. Cell Cycle. 5(13): 1422-5.
  • Hoffman B, et al. (2007) Role of gadd45 in myeloid cells in response to hematopoietic stress. Blood Cells Mol Dis. 39(3): 344-7.
  • Rosemary Siafakas A, et al. (2009) Growth arrest and DNA damage-45 alpha (GADD45alpha). Int J Biochem Cell Biol. 41(5): 986-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items