Quick Order

Human CCL22 / MDC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL22cDNA Clone Product Information
Gene_bank_ref_id:NM_002990.3
cDNA Size:282
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 22 DNA.
Gene Synonym:CCL22, MDC, ABCD-1, SCYA22, STCP-1, DC/B-CK, MGC34554, A-152E5.1
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CCL22 / MDC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name
Background

Chemokine (C-C motif) ligand 22(ABCD-1 / CCL22)is a kind of CC chemokine which is a family of secreted proteins involved in immunoregulatory and inflammatory processes. The cytokine displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. This ABCD-1 / CCL22 chemokine binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated / effector T lymphocytes to inflammatory sites and other aspects of activated T-lymphocyte physiology. ABCD-1 / CCL22 is highly expressed in macrophage and in monocyte-derived dendritic cells, and thymus, and in Langerhans' cell histiocytosis and atopic dermatitis but not in dermatopathic lymphadenopathy. This chemokine is also found in lymph node, appendix, activated monocytes, resting and activated macrophages. This protein is lower expressed in lung and spleen and very weekly expressed in small intestine.

References
  • Vulcano M, et al. (2001) Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo. Eur J Immunol. 31(3): 812-22.
  • Kwon DJ, et al. (2011) Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-?B and STAT1 activation in HaCaT cells. Biochem Biophys Res Commun. 417(4):1254-9.
  • Hirota T, et al. (2011) Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies. PLoS One. 6(11):e26987.
  •  

    CCL22/MDC related areas, pathways, and other information

    Size / Price
    Catalog:HG10163-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"