Quick Order

Human EZR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EZRcDNA Clone Product Information
cDNA Size:1761
cDNA Description:ORF Clone of Homo sapiens ezrin DNA.
Gene Synonym:CVL, CVIL, VIL2, HEL-S-105
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal ganglia, hippocampus, hypophysis, and optic nerve. VIL2 contains 1 FERM domain and may be involved in connections of major cytoskeletal structures to the plasma membrane. It plays a key role in cell surface structure adhesion, migration, and organization. In epithelial cells, VIL2 is required for the formation of microvilli and membrane ruffles on the apical pole. It interacts with MPP5 and SLC9A3R2. It is found VIL2 form a complex with PODXL and SLC9A3R2. It also interacts with MCC, PLEKHG6, PODXL, SCYL3/PACE1, SLC9A3R1 and TMEM8B.

  • Grnholm M, et al. (1999) Homotypic and heterotypic interaction of the neurofibromatosis 2 tumor suppressor protein merlin and the ERM protein ezrin. J Cell Sci. 112(6):895-904.
  • Sitaraman, et al. (2002) The adenosine 2b receptor is recruited to the plasma membrane and associates with E3KARP and Ezrin upon agonist stimulation. J Biol Chem. 277(36):33188-95.
  • Gould KL, et al. (1989) cDNA cloning and sequencing of the protein-tyrosine kinase substrate, ezrin, reveals homology to band 4.1. EMBO J. 8(13):4133-42.