Quick Order

Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ATP6V0D1cDNA Clone Product Information
Gene_bank_ref_id:XM_005592264.1
cDNA Size:1056
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 DNA.
Gene Synonym:ATP6V0D1
Species:Cynomolgus
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90337-ACG$325
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90337-ACR$325
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90337-ANG$325
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90337-ANR$325
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90337-CF$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90337-CH$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90337-CM$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90337-CY$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone)CG90337-G$95
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90337-NF$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90337-NH$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90337-NM$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90337-NY$295
Cynomolgus monkey ATP6V0D1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90337-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:CG90337-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"