Quick Order

Human LGMN Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LGMNcDNA Clone Product Information
cDNA Size:1302
cDNA Description:ORF Clone of Homo sapiens legumain DNA.
Gene Synonym:AEP, LGMN1, PRSC1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

  • Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.
  • Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.
  • Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.
  • Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.
  • Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.
  • Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items