Quick Order

Human S100A12 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A12 cDNA Clone Product Information
Gene_bank_ref_id:NM_005621.1
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A5 with N terminal Myc tag.
Gene Synonym:p6, CAGC, CGRP, MRP6, CAAF1, ENRAGE, S100A12
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. 

Protein S100-A12, also known as S100 calcium-binding protein A12, Calcium-binding protein in amniotic fluid 1, Calgranulin-C, and S100A12, is a member of the S-101 family. Like the majority of S100 proteins, S100A12 is a dimer, with the interface between the two subunits being composed mostly of hydrophobic residues. The fold of S100A12 is similar to the other known crystal and solution structures of S100 proteins, except for the linker region between the two EF-hand motifs. S100A12 plays an important role in the inflammatory response.

References
  • Moroz, OV. et al., 2001, Acta Crystallogr D Biol Crystallogr. 57: 20-9.
  • Foell, D. et al., 2003, Lancet  361 (9365):1270-2.
  • Vogl, T. et al., 2004, Blood. 104: 4260-8.
  • Viemann, D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani, Y. et al., 2005, Mediators Inflamm. 2005: 280-292.
  • Bjoerk, P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Catalog: HG11143-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"