Quick Order

Human FKBP7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FKBP7cDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Homo sapiens FK506 binding protein 7 DNA.
Gene Synonym:FKBP23, PPIase, FKBP7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3 subfamily. PPIase contains 1 PPIase cyclophilin-type domain. Members of the immunophilin protein family play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. It has a very high substrate specificity for the four-residue peptide Ala-Ala-Pro-Phe only when the proline peptide bond is in the trans state. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium.

  • 1. Shor B, et al. (2008) A new pharmacologic action of CCI-779 involves FKBP12-independent inhibition of mTOR kinase activity and profound repression of global protein synthesis. Cancer Res. 68(8):2934-43.
  • 2. Talmud PJ, et al. (2009) Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. Am J Hum Genet. 85(5):628-42.
  • 3. Deleersnijder A, et al. (2011) Comparative analysis of different peptidyl-prolyl isomerases reveals FK506-binding protein 12 as the most potent enhancer of alpha-synuclein aggregation. J Biol Chem. 286(30):26687-701.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items