Quick Order

Human CD31 / PECAM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PECAM1cDNA Clone Product Information
cDNA Size:2217
cDNA Description:ORF Clone of Homo sapiens platelet/endothelial cell adhesion molecule (PECAM1) DNA.
Gene Synonym:PECAM1, CD31, PECAM-1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items