Quick Order

Cynomolgus monkey ART4 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus ART4 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:993bp
cDNA Description:Full length Clone DNA of Macaca mulatta ADP-ribosyltransferase 4 (Dombrock blood group) with N terminal His tag.
Gene Synonym:ART4
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ADP-ribosyltransferase 4 (Dombrock blood group), also known as Mono-ADP-ribosyltransferase 4(ART4), Dombrock blood group carrier molecule and CD297, is a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. ART4 could be detected on HEL cells and erythrocytes by FACS analysis while it was absent from activated monocytes, despite the presence of ART4 mRNA in these cells. ART is also known as the carrier of the Dombrock blood group alloantigens (Do) which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane.

References
  • Parusel I, et al. (2005) A panel of monoclonal antibodies recognizing GPI-anchored ADP-ribosyltransferase ART4, the carrier of the Dombrock blood group antigens. Cell Immunol. 236(1-2): 59-65.
  • Friedrich M, et al. (2005) Analysis of the 3' UTR of the ART3 and ART4 gene by 3' inverse RACE-PCR. DNA Seq. 16(1): 53-7.
  • Okazaki IJ, et al. (1998) Glycosylphosphatidylinositol-anchored and secretory isoforms of mono-ADP-ribosyltransferases. J Biol Chem. 273(37): 23617-20.
  • Size / Price
    Catalog: CG90272-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"