Quick Order

Human IL1F2 / IL1B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL1BcDNA Clone Product Information
cDNA Size:810
cDNA Description:ORF Clone of Homo sapiens interleukin 1, beta (IL1B) DNA.
Gene Synonym:IL1B, IL-1, IL1F2, IL1-BETA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-1 Family & Receptor Related Products
Product nameProduct name
Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1RL1 / DER4 ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL1R2 / IL1RB / CD121b ProteinHuman IL18 / Interleukin 18 / IGIF Protein (GST Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL36G / IL1F9 Protein (aa 18-169, His Tag)Human IL36G / IL1F9 ProteinHuman IL36G / IL1F9 Protein (aa 18-169)Human IL1F5 / IL36RN ProteinHuman IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL1R1 / CD121a ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Human IL-1 beta / IL1B ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1R9 / IL1RAPL2 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL33 / Interleukin-33 / NF-HEV ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Human MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Human IL36B / IL1F8 Protein (His Tag)Human IL36B / IL1F8 ProteinHuman IL1F6 / IL36A Protein (His Tag)Human IL1F6 / IL36A ProteinHuman IL1F6 / IL36 Protein (aa 6-158)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman JNK2 / MAPK9 Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human SIGIRR / TIR8 Protein (Fc Tag) Human SIGIRR / TIR8 Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Feline IL1B / IL-1 beta ProteinHuman IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL18 / IL-18 ProteinMouse IL-18R1 Protein (His & Fc Tag)Mouse IL18R1 / CD218a Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinMouse IL-1 beta / IL1B ProteinMouse IL-1 alpha / IL1A / IL1F1 ProteinMouse SIGIRR / TIR8 Protein (His & Fc Tag)Mouse IL18BP Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Mouse IL1RL1 / ST2 Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (His Tag)Mouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Mouse IL1F8 / IL36b ProteinMouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinCanine IL-1 beta / IL1B ProteinRat IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL-1 beta / IL1B Protein (mature form)Rat IL1R1 / CD121a Protein (His & Fc Tag)Rat IL1R1 / CD121a Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL1RL1 / ST2 Protein (His Tag)Cynomolgus IL-1 beta / IL1B ProteinCynomolgus IL-18 / IL-1F4 Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Cynomolgus IL18RAP Protein (Fc Tag)Cynomolgus IL18RAP Protein (His Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items