After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACBD6 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACBD6 cDNA Clone Product Information
Gene_bank_ref_id:NM_032360.2
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens acyl-Coenzyme A binding domain containing 6 with N terminal Myc tag.
Gene Synonym:MGC2404, ACBD6
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Human acyl-coenzyme A binding domain-containing member 6 (ACBD6) is a modular protein that carries an acyl-CoA binding domain at its N terminus and two ankyrin motifs at its C terminus. In mammals, there are six members of the acyl-CoA binding domain-containing (ACBD) family, and their annotation is not uniform. All six ACBD proteins contain an ACB domain at the N terminus, but they do not share significant homology at the C-terminal region. ACBD6 is a 32 kDa protein that is predicted by sequence analysis to carry an ACB domain between residues 42 and 125 and two ANK motifs at its C terminus. This protein binds long-chain acyl-CoAs with a strong preference for unsaturated, C18:1-CoA and C20:4-CoA, over saturated, C16:0-CoA, acyl species. ACBD6 is not a ubiquitous protein, but it is expressed in hematopoietic tissues and appears to be restricted to primitive stem cells present in those tissues with functions in blood and vessel development. ACBD6 was detected in bone marrow, spleen, placenta, cord blood, circulating CD34+ progenitors, and embryonic-like stem cells derived from placenta. In placenta, the protein was only detected in CD34+ progenitor cells present in blood and in CD31+ endothelial cells surrounding the blood vessels. These cells were also positive for the marker CD133, and they probably constitute hemangiogenic stem cells, precursors of both blood and vessels. We propose that human ACBD6 represents a cellular marker for primitive progenitor cells with functions in hematopoiesis and vascular endothelium development.

References
  • Soupene E, et al. (2008) Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells. J Lipid Res. 49(5): 1103-12.
  • Size / Price
    Catalog: HG11112-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"