After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL1RNcDNA Clone Product Information
cDNA Size:534
cDNA Description:ORF Clone of Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript variant 1 DNA.
Gene Synonym:IL1RN, IRAP, IL1F3, IL1RA, IL-1ra3, ICIL-1RA, MGC10430
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10123-ACG$325
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10123-ACR$325
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10123-CF$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10123-CH$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10123-CM$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10123-CY$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10123-M$95
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10123-M-F$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10123-M-N$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10123-NF$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10123-NH$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10123-NM$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10123-NY$295
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10123-UT$295
 Learn more about expression Vectors
IL-1 Family & Receptor Related Products
Product nameProduct name
Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1RL1 / DER4 ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL1R2 / IL1RB / CD121b ProteinHuman IL18 / Interleukin 18 / IGIF Protein (GST Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL36G / IL1F9 Protein (aa 18-169, His Tag)Human IL36G / IL1F9 ProteinHuman IL36G / IL1F9 Protein (aa 18-169)Human IL1F5 / IL36RN ProteinHuman IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL1R1 / CD121a ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Human IL-1 beta / IL1B ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1R9 / IL1RAPL2 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL33 / Interleukin-33 / NF-HEV ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Human MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Human IL36B / IL1F8 Protein (His Tag)Human IL36B / IL1F8 ProteinHuman IL1F6 / IL36A Protein (His Tag)Human IL1F6 / IL36A ProteinHuman IL1F6 / IL36 Protein (aa 6-158)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman JNK2 / MAPK9 Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Human SIGIRR / TIR8 Protein (Fc Tag) Human SIGIRR / TIR8 Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Feline IL1B / IL-1 beta ProteinHuman IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL18 / IL-18 ProteinMouse IL-18R1 Protein (His & Fc Tag)Mouse IL18R1 / CD218a Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinMouse IL-1 beta / IL1B ProteinMouse IL-1 alpha / IL1A / IL1F1 ProteinMouse SIGIRR / TIR8 Protein (His & Fc Tag)Mouse IL18BP Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Mouse IL1RL1 / ST2 Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (Fc Tag)Mouse IL1R1 / CD121a Protein (His Tag)Mouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Mouse IL1F8 / IL36b ProteinMouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinCanine IL-1 beta / IL1B ProteinRat IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL-1 beta / IL1B Protein (mature form)Rat IL1R1 / CD121a Protein (His & Fc Tag)Rat IL1R1 / CD121a Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL1RL1 / ST2 Protein (His Tag)Cynomolgus IL-1 beta / IL1B ProteinCynomolgus IL-18 / IL-1F4 Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Cynomolgus IL18RAP Protein (Fc Tag)Cynomolgus IL18RAP Protein (His Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.

  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items