Quick Order

Cynomolgus monkey TLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TLR2cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:2355
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) toll-like receptor 2 DNA.
Gene Synonym:TLR2
Species:Cynomolgus
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

References
  • Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.
  • Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.
  • Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.
  • Size / Price
    Catalog:CG90254-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"