Quick Order

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DUSP3cDNA Clone Product Information
Gene_bank_ref_id:NM_004090.3
cDNA Size:558
cDNA Description:ORF Clone of Homo sapiens dual specificity phosphatase 3 DNA.
Gene Synonym:DUSP3, VHR
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10114-ACG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10114-ACR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10114-ANG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10114-ANR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10114-CF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10114-CH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10114-CM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10114-CY$295
Human VHR Gene cDNA Clone (full-length ORF Clone)HG10114-M$95
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10114-M-F$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-M-N$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10114-NF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10114-NH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10114-NM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10114-NY$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

References
  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Catalog:HG10114-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"