Quick Order

Text Size:AAA

Human CA5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA5BcDNA Clone Product Information
cDNA Size:954
cDNA Description:ORF Clone of Homo sapiens carbonic anhydrase VB, mitochondrial DNA.
Gene Synonym:CA-VB, CA5B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Carbonic anhydrase 5B, also known as carbonate dehydratase VB, carbonic anhydrase VB, CA-VB and CA5B, is a member of the alpha-carbonic anhydrase family. The strongest expression of CA5B / CA-VB is in heart, pancreas, kidney, placenta, lung, and skeletal muscle. It is not expressed in liver. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CAs show extensive diversity in tissue distribution and in their subcellular localization. CA5B / CA-VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA5A / CA-VA. CA5B / CA-VB has a wider tissue distribution than CA5A / CA-VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt). CA5B / CA-VB is inhibited by coumarins, sulfonamide derivatives such as acetazolamide (AZA), saccharin and Foscarnet (phosphonoformate trisodium salt).

  • Fujikawa-Adachi K, et al.,1999, J Biol Chem. 274 (30): 21228-33.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Maresca, A.et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items