Quick Order

Human LTF Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LTFcDNA Clone Product Information
Gene_bank_ref_id:NM_002343.2
cDNA Size:2133
cDNA Description:ORF Clone of Homo sapiens lactotransferrin DNA.
Gene Synonym:LF, HLF2, GIG12
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe3+ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.

References
  • Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.
  • Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.
  • Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.
  • Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.
  • Size / Price
    Catalog:HG11096-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"