Quick Order

Human SMYD2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SMYD2 cDNA Clone Product Information
NCBI RefSeq:NM_020197.2
RefSeq ORF Size:1302bp
cDNA Description:Full length Clone DNA of Homo sapiens SET and MYND domain containing 2 with N terminal Myc tag.
Gene Synonym:KMT3C, HSKM-B, ZMYND14, MGC119305, SMYD2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SET and MYND domain-containing protein 2, also known as HSKM-B, SMYD2, and KMT3C, is a member of the SMYD protein family. It contains one MYND-type zinc finger and one SET domain. Not much is known about SMYD2. However, the interest in better understanding the roles of SMYD2 has grown because of reports indicating that SMYD2 methylates p53 and histone H3. In Xenopus, SMYD1 and SMYD2 were expressed in various muscle tissues and related to muscle cells differentiation. SMYD2 mRNA is most highly expressed in heart and brain tissue. Over-expressed SMYD2 localizes to the cytoplasm and the nucleus in 293T cells. SMYD2 appears to restrain cell proliferation, likely through direct modulation of chromatin structure. Patients with SMYD2-overexpressing tumors had a worse overall rate of survival than those with non-expressing tumors, and SMYD2 positivity was independently associated with a worse outcome in the multivariate analysis. SMYD2 plays an important role in tumor cell proliferation through its activation/overexpression and regards as a prognosticator and potential therapeutic target in esophageal squamous cell carcinoma (ESCC).

Size / Price
Catalog: HG11093-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"